25

I am using Python/Selenium to submit genetic sequences to an online database, and want to save the full page of results I get back. Below is the code that gets me to the results I want:

from selenium import webdriver

URL = 'https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastx&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome'
SEQUENCE = 'CCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACA' #'GAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGA'
CHROME_WEBDRIVER_LOCATION = '/home/max/Downloads/chromedriver' # update this for your machine

# open page with selenium
# (first need to download Chrome webdriver, or a firefox webdriver, etc)
driver = webdriver.Chrome(executable_path=CHROME_WEBDRIVER_LOCATION)
driver.get(URL)
time.sleep(5)

# enter sequence into the query field and hit 'blast' button to search
seq_query_field = driver.find_element_by_id("seq")
seq_query_field.send_keys(SEQUENCE)

blast_button = driver.find_element_by_id("b1")
blast_button.click()
time.sleep(60)

At that point I have a page that I can manually click "save as," and get a local file (with a corresponding folder of image/js assets) that lets me view the whole returned page locally (minus content which is generated dynamically from scrolling down the page, which is fine). I assumed there would be a simple way to mimic this 'save as' function in python/selenium but haven't found one. The code to save the page below just saves html, and does not leave me with a local file that looks like it does in the web browser, with images, etc.

content = driver.page_source
with open('webpage.html', 'w') as f:
    f.write(content)

I've also found this question/answer on SO, but the accepted answer just brings up the 'save as' box, and does not provide a way to click it (as two commenters point out)

Is there a simple way to 'save [full page] as' using python? Ideally I'd prefer an answer using selenium since selenium makes the crawling part so straightforward, but I'm open to using another library if there's a better tool for this job. Or maybe I just need to specify all of the images/tables I want to download in code, and there is no shortcut to emulating the right-click 'save as' functionality?

UPDATE - Follow up question for James' answer So I ran James' code to generate a page.html (and associated files) and compared it to the html file I got from manually clicking save-as. The page.html saved via James' script is great and has everything I need, but when opened in a browser it also shows a lot of extra formatting text that's hidden in the manually save'd page. See attached screenshot (manually saved page on the left, script-saved page with extra formatting text shown on right). enter image description here

This is especially surprising to me because the raw html of the page saved by James' script seems to indicate those fields should still be hidden. See e.g. the html below, which appears the same in both files, but the text at issue only appears in the browser-rendered page on the one saved by James' script:

<p class="helpbox ui-ncbitoggler-slave ui-ncbitoggler" id="hlp1" aria-hidden="true">
These options control formatting of alignments in results pages. The
default is HTML, but other formats (including plain text) are available.
PSSM and PssmWithParameters are representations of Position Specific Scoring Matrices and are only available for PSI-BLAST. 
The Advanced view option allows the database descriptions to be sorted by various indices in a table.
</p>

Any idea why this is happening?

Max Power
  • 7,520
  • 9
  • 46
  • 83
  • check this question https://codereview.stackexchange.com/q/78775/179828 – Moshe Slavin Dec 12 '18 at 13:58
  • thanks for this Moshe, although from the description that it saves "html content of page(without CSS) and also it looks for all images on page and save them too" it's not quite what I'm looking for. Also, more importantly to me, I want to leverage a crawling tool like Selenium or maybe Scrapy because I need to do a bit of crawling to get to my results page, I can't just give a URL as an input. I also prefer to use a tool like Selenium/Scrapy/bs4 than to use regex to parse html as this answer does. – Max Power Dec 14 '18 at 16:31
  • Would you consider a valid solution one which uses a Firefox addon? Translating [this answer](https://stackoverflow.com/questions/28114612/selenium-save-website-including-all-images-css-dom) to Python looks like a plausible task. – Tomas Farias Dec 24 '18 at 20:52
  • thanks for the suggestion, Tomas. Although that answer refers to the following dead link for the firefox plugin - https://addons.mozilla.org/de/firefox/addon/scrapbook/. Googling, I find https://addons.mozilla.org/en-US/firefox/addon/web-scrapbook/, but that has the following warning text in bold "**This addon is under development. Every feature could change in the future. Use in production carefully and be sure to make a backup frequently.**" So I will probably not build around this for now, but I appreciate your pointing me to it – Max Power Dec 27 '18 at 17:07
  • i faced similar issue regarding clicking the save as button..a solution would be to click on the save as button using pywin32.. https://stackoverflow.com/questions/1181464/controlling-mouse-with-python – iamklaus Dec 28 '18 at 16:29

4 Answers4

13

As you noted, Selenium cannot interact with the browser's context menu to use Save as..., so instead to do so, you could use an external automation library like pyautogui.

pyautogui.hotkey('ctrl', 's')
time.sleep(1)
pyautogui.typewrite(SEQUENCE + '.html')
pyautogui.hotkey('enter')

This code opens the Save as... window through its keyboard shortcut CTRL+S and then saves the webpage and its assets into the default downloads location by pressing enter. This code also names the file as the sequence in order to give it a unique name, though you could change this for your use case. If needed, you could additionally change the download location through some extra work with the tab and arrow keys.

Tested on Ubuntu 18.10; depending on your OS you may need to modify the key combination sent.


Full code, in which I also added conditional waits to improve speed:

import time
from selenium import webdriver
from selenium.webdriver.common.by import By
from selenium.webdriver.support.expected_conditions import visibility_of_element_located
from selenium.webdriver.support.ui import WebDriverWait
import pyautogui

URL = 'https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastx&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome'
SEQUENCE = 'CCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACA' #'GAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGA'

# open page with selenium
# (first need to download Chrome webdriver, or a firefox webdriver, etc)
driver = webdriver.Chrome()
driver.get(URL)

# enter sequence into the query field and hit 'blast' button to search
seq_query_field = driver.find_element_by_id("seq")
seq_query_field.send_keys(SEQUENCE)

blast_button = driver.find_element_by_id("b1")
blast_button.click()

# wait until results are loaded
WebDriverWait(driver, 60).until(visibility_of_element_located((By.ID, 'grView')))

# open 'Save as...' to save html and assets
pyautogui.hotkey('ctrl', 's')
time.sleep(1)
pyautogui.typewrite(SEQUENCE + '.html')
pyautogui.hotkey('enter')
FThompson
  • 27,808
  • 11
  • 55
  • 91
  • I think for customizing save location, I will just save to default location, then use `subprocess.call('mv [current-location] [new-location]')` instead of relying on preset tab and arrow strokes via the gui. – Max Power Dec 29 '18 at 17:50
  • 'Save as...' didn't work for me initially on MacOS. But changing `pyautogui.hotkey('command','s')` to `pyautogui.keyDown('command') pyautogui.press('s')` resolved the issue. Works perfectly fine! – tadvas Jan 08 '21 at 15:50
5

This is not a perfect solution, but it will get you most of what you need. You can replicate the behavior of "save as full web page (complete)" by parsing the html and downloading any loaded files (images, css, js, etc.) to their same relative path.

Most of the javascript won't work due to cross origin request blocking. But the content will look (mostly) the same.

This uses requests to save the loaded files, lxml to parse the html, and os for the path legwork.

from selenium import webdriver
import chromedriver_binary
from lxml import html
import requests
import os

driver = webdriver.Chrome()
URL = 'https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastx&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome'
SEQUENCE = 'CCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACA' 
base = 'https://blast.ncbi.nlm.nih.gov/'

driver.get(URL)
seq_query_field = driver.find_element_by_id("seq")
seq_query_field.send_keys(SEQUENCE)
blast_button = driver.find_element_by_id("b1")
blast_button.click()

content = driver.page_source
# write the page content
os.mkdir('page')
with open('page/page.html', 'w') as fp:
    fp.write(content)

# download the referenced files to the same path as in the html
sess = requests.Session()
sess.get(base)            # sets cookies

# parse html
h = html.fromstring(content)
# get css/js files loaded in the head
for hr in h.xpath('head//@href'):
    if not hr.startswith('http'):
        local_path = 'page/' + hr
        hr = base + hr
    res = sess.get(hr)
    if not os.path.exists(os.path.dirname(local_path)):
        os.makedirs(os.path.dirname(local_path))
    with open(local_path, 'wb') as fp:
        fp.write(res.content)

# get image/js files from the body.  skip anything loaded from outside sources
for src in h.xpath('//@src'):
    if not src or src.startswith('http'):
        continue
    local_path = 'page/' + src
    print(local_path)
    src = base + src
    res = sess.get(hr)
    if not os.path.exists(os.path.dirname(local_path)):
        os.makedirs(os.path.dirname(local_path))
    with open(local_path, 'wb') as fp:
        fp.write(res.content)  

You should have a folder called page with a file called page.html in it with the content you are after.

James
  • 29,484
  • 4
  • 43
  • 62
  • hey James, thanks this is really great, although I'm confused why it also shows a bunch of extra text which is hidden when the page is saved manually (see more details in the update to my question at the bottom). Do you understand why this is happening? – Max Power Dec 29 '18 at 04:06
  • 1
    Those are elements that are normally hidden by javascript. One of the downloaded JS libraries may be calling another library that was not downloaded. – James Dec 29 '18 at 13:09
1

Inspired by FThompson's answer above, I came up with the following tool that can download full/complete html for a given page url (see: https://github.com/markfront/SinglePageFullHtml)

UPDATE - follow up with Max's suggestion, below are steps to use the tool:

  1. Clone the project, then run maven to build:
$> git clone https://github.com/markfront/SinglePageFullHtml.git

$> cd ~/git/SinglePageFullHtml
$> mvn clean compile package
  1. Find the generated jar file in target folder: SinglePageFullHtml-1.0-SNAPSHOT-jar-with-dependencies.jar

  2. Run the jar in command line like:

$> java -jar .target/SinglePageFullHtml-1.0-SNAPSHOT-jar-with-dependencies.jar <page_url>
  1. The result file name will have a prefix "FP, followed by the hashcode of the page url, with file extension ".html". It will be found in either folder "/tmp" (which you can get by System.getProperty("java.io.tmp"). If not, try find it in your home dir or System.getProperty("user.home") in Java).

  2. The result file will be a big fat self-contained html file that includes everything (css, javascript, images, etc.) referred to by the original html source.

Mark Front
  • 29
  • 3
  • 1
    Hey Mark, welcome to Stack Overflow! Someone seems to have voted you down, I just voted you up because I think it's awesome you built a thing to provide a solution for this. But in general people prefer an answer like this (mainly a description of a link) to be a comment. For an answer that more people will vote up than vote down, people here prefer a minimal working code example. So I would suggest you copy over the code/steps from your 'usage' section in your github readme to your answer here, or delete this answer and leave your link and description of it in a comment. – Max Power Aug 25 '20 at 20:01
-2

I'll advise u to have a try on sikulix which is an image based automation tool for operate any widgets within PC OS, it supports python grammar and run with command line and maybe the simplest way to solve ur problem. All u need to do is just give it a screenshot, call sikulix script in ur python automation script(with OS.system("xxxx") or subprocess...).

Lau Real
  • 305
  • 1
  • 2
  • 14