Bioinformatics Stack Exchange
Bioinformatics Stack Exchange

Most Popular

more tags
1500 questions
6
votes
2 answers

BioPython internal_coords module returns different dihedral angles for the (seemingly) same protein structure

I am using the internal_coords module from BioPython in order to compare dihedral angles of two different conformations of the same protein. The conformations are processed by me in order to make sure that their residues are aligned and they always…
CubeHead
  • 425
  • 2
  • 8
6
votes
1 answer

Nextflow: dynamically setting resource directives for a process

I'm trying to test variations of CPU and memory for a specific process (samtools sort) to measure computational efficiency (measured only by time). To do this, I'd like to set the CPU and memory for a Nextflow process dynamically. Ultimate question:…
Mark Ebbert
  • 1,354
  • 10
  • 22
6
votes
2 answers

How to display novel genome assemblies or uncommon genome assemblies using the UCSC Genome Browser?

I want to display E.coli BW25113 (GenBank: CP009273.1) strain in UCSC browser. This strain is not listed in http://microbes.ucsc.edu/ browser. How can I display E.coli BW25113 assembly in the browser?
Supertech
  • 606
  • 2
  • 10
6
votes
1 answer

Why do SAM and BAM use different coordinate systems?

BAM files are, at least as far as I know, simply binary compressed versions of SAM files. They have the exact same information and are used in the same way. Why then does the SAM format use a 1-based coordinate system while BAM uses a 0-based…
terdon
  • 10,071
  • 5
  • 22
  • 48
6
votes
2 answers

How to compare 2 whole genome sequences

I have the files of 2 persons that got whole genome sequencing, one by nebula genomics and the other by dante labs. I want to compare their genomes to see if they are father and son. I want to see exactly which genetic sequences they share. In the…
guy
  • 61
  • 1
6
votes
1 answer

Is there an efficient way to extract CIGAR strings for read pairs from bam files with python?

I am working with bam files and I have to check if reads of a specific position or their mates are soft clipped. So, I am looking for a fast way to extract the read pairs from a bam file in python. So far, I use pysam and fetch reads of a given…
Mereven
  • 61
  • 2
6
votes
1 answer

How to share a collection of sbol designs in SynBioHub

We currently work on a project that will generate a collection of recombinant plasmids targeting over 3500 genes of the cyanobacterium Synechocystis sp. PCC 6803. We would like to share these designs in SynBioHub but we are not sure how best to go…
Zielu
  • 179
  • 3
6
votes
1 answer

In SBOL, is there a way to distinguish biological replicates?

I have a library of biological implementations (i.e. plasmids) of genetic circuits and their experimental data associated. I want to implement an in silico version with SBOL, but to be consistent with what I have I'm my freezer, I need to identify…
Alejandro Vignoni
  • 205
  • 1
  • 4
6
votes
1 answer

How to search for high coverage SRA entries

The Question I want to find high coverage SRA entries, e.g., above 100x. I guess the best way is to use https://www.ncbi.nlm.nih.gov/sra with an appropriate search term. I don't mind if the search results contain some "false-positives". (I.e., if…
Oren Milman
  • 261
  • 1
  • 8
6
votes
2 answers

Parallel processing of scripts that use obitools

I have an obitools script (de Barba et al. 2016) that I would like to run faster. How would you run it in parallel to cut down on time? illuminapairedend -r rawdata_scandinavia_R2.fastq rawdata_scandinavia_R1.fastq | tee rawdata_scandinavia.fastq |…
Roman Luštrik
  • 241
  • 3
  • 8
6
votes
2 answers

BinaryCIF vs MMTF formats, which one to choose?

Both file formats are advertised as more memory/parsing efficent than old PDB format and its successor mmCIF format, but I can't understand the context (I'm a developer, but pretty new to the field of bioinformatics). Is BinaryCIF a later iteration…
ashas
  • 63
  • 4
6
votes
0 answers

Using dssp after chain extraction

I have a list of PDB IDs with realtive chains IDs that have to be extracted, and then run on dssp. For the single chain extraction I tried several methods, such as: import pymol2 for entry in list: with pymol2.PyMOL() as pymol: …
saiden
  • 171
  • 4
6
votes
1 answer

Biohackers Netflix - DNA to binary and video

I'm not sponsored or anything, just interested in their challenge to decipher their DNA code. They encoded their first episode of "Biohackers" video/binary file to DNA code and said if we could decode it we can watch it (without Netflix). Here's…
xamax
  • 63
  • 4
6
votes
4 answers

Extract residue sequence from pdb file (in biopython, but open to recommendations)

I'm new to Biopython and I'd like to extract the sequence of residues from a pdb file. My two questions are: What is the simplest way to do this? (Esp. when there is more than one sequence) and Should I be worried about "PDBConstructionWarning:…
mzzx
  • 175
  • 1
  • 1
  • 4
6
votes
1 answer

How to filter out cross alignments from a BED file?

I have a BAM file: @SQ SN:chr1 LN:248956422 @SQ SN:chrx LN:248956423 ST-E00110:348:HGVKKALXX:1:1201:5822:48670 323 chr1 9999 0 67H66M16H chrx 1000 0 GATAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC …
SmallChess
  • 2,699
  • 3
  • 19
  • 35
1 2 3
…
99 100