I wrote a command-line k-mer counter called kmer-counter that will output results in a form that your Python script can consume: https://github.com/alexpreynolds/kmer-counter
You can grab, build and install it like so:
$ git clone https://github.com/alexpreynolds/kmer-counter.git
$ cd kmer-counter
$ make
$ cp kmer-counter /usr/local/bin
Once the binary is in your path, you might use it in Python like so:
k = 6
fastaFile = '/path/to/some/seqs.fa'
kmerCmd = 'kmer-counter --fasta --k=%d %s' % (k, fastaFile)
try:
output = subprocess.check_output(kmerCmd, shell=True)
result = {}
for line in output.splitlines():
(header, counts) = line.strip().split('\t')
header = header[1:]
kmers = dict((k,int(v)) for (k,v) in [d.split(':') for d in counts.split(' ')])
result[header] = kmers
sys.stdout.write("%s" % (str(result)))
except subprocess.CalledProcessError as error:
sys.stderr.write("%s" % (str(error)))
Given example FASTA like this:
>foo
TTAACG
>bar
GTGGAAGTTCTTAGGGCATGGCAAAGAGTCAGAATTTGAC
For k=6, you would get an iterable Python dictionary like this:
{'foo': {'TTAACG': 1, 'CGTTAA': 1}, 'bar': {'GTTCTT': 1, 'AGAACT': 1, 'GAGTCA': 1, 'ATGGCA': 1, 'GAACTT': 1, 'ATTCTG': 1, 'CTAAGA': 1, 'CTTCCA': 1, 'ATTTGA': 1, 'GGAAGT': 1, 'AGGGCA': 1, 'CCTAAG': 1, 'CTCTTT': 1, 'AATTTG': 1, 'TCTGAC': 1, 'TTTGCC': 1, 'CTTAGG': 1, 'TTTGAC': 1, 'GAAGTT': 1, 'CCCTAA': 1, 'AGAATT': 1, 'AGTCAG': 1, 'CTGACT': 1, 'TCTTAG': 1, 'CGTTAA': 1, 'GTGGAA': 1, 'TGCCAT': 1, 'ACTCTT': 1, 'GGGCAT': 1, 'TTAGGG': 1, 'CTTTGC': 1, 'TGGAAG': 1, 'GACTCT': 1, 'CATGCC': 1, 'GCAAAG': 1, 'AAATTC': 1, 'GTCAAA': 1, 'TGACTC': 1, 'TAGGGC': 1, 'AAGTTC': 1, 'ATGCCC': 1, 'TCAAAT': 1, 'CAAAGA': 1, 'AACTTC': 1, 'GTCAGA': 1, 'CAAATT': 1, 'TAAGAA': 1, 'CATGGC': 1, 'AAGAAC': 1, 'AAGAGT': 1, 'TCTTTG': 1, 'TTCCAC': 1, 'TGGCAA': 1, 'GGCAAA': 1, 'AGTTCT': 1, 'AGAGTC': 1, 'TCAGAA': 1, 'GAATTT': 1, 'AAAGAG': 1, 'TGCCCT': 1, 'CCATGC': 1, 'GGCATG': 1, 'TTGCCA': 1, 'CAGAAT': 1, 'AATTCT': 1, 'GCATGG': 1, 'ACTTCC': 1, 'TTCTTA': 1, 'GCCATG': 1, 'GCCCTA': 1, 'TTCTGA': 1}}
You can use standard Python calls to manipulate this dictionary object and get sums of counts per record, for sequence, etc. which seems to answer your question. Please feel free to clarify what you're looking for if this object representation is not clear.
For a fully-fleshed out demonstration, see: https://github.com/alexpreynolds/kmer-counter/blob/master/test/kmer-test.py