I am trying to index wheat genome using STAR through following command
STAR --runMode genomeGenerate --genomeFastaFiles Triticum_aestivum.TGACv1.dna_sm.toplevel.fa --runThreadN 28
But getting following error,
terminate called after throwing an instance of 'std::bad_alloc'
what(): std::bad_alloc
Aborted (core dumped)
The size of the genome is 13.5 GB and the server capacity is 32 cores with 125 GB RAM, how this error can be resolved?
I have decreased the number of threads to 8 but again getting the same error as shown below:
> STAR --runMode genomeGenerate --runThreadN 8 --genomeDir wheat --genomeFastaFiles wheat.fa
Jun 04 02:13:31 ..... started STAR run
Jun 04 02:13:31 ... starting to generate Genome files
terminate called after throwing an instance of 'std::bad_alloc'
what(): std::bad_alloc
Aborted (core dumped)
Even I have tried to use STAR without any threads but still the same error:
> STAR --runMode genomeGenerate --genomeDir wheat --genomeFastaFiles wheat.fa
Jun 04 02:19:44 ..... started STAR run
Jun 04 02:19:44 ... starting to generate Genome files
terminate called after throwing an instance of 'std::bad_alloc'
what(): std::bad_alloc
Aborted (core dumped)
May there can be an issue in reference of wheat that I am using, I got this reference from here. Here are the first ten lines of the reference using head command:
> head wheat.fa
>Pt dna:chromosome chromosome:TGACv1:Pt:1:135835:1 REF
ACAGAAATACCCAATATCTTGTTCTAGCAAGATATTGGGTATTTCTGTCTTTTCTTTCTT
CAAAAATTCTTATATGTTAGCAGAAAAACCTTATCCATTAATAGATGGAACTTCAACAGC
AGCTAAGTCTAGAGGGAAGTTGTGAGCATTACGTTCGTGCATTACTTCCATACCAAGGTT
AGCACGGTTGATGATATCAGCCCAAGTATTAATAACGCGACCTTGACTATCAACTACAGA
TTGGTTGAAATTGAAACCATTTAGGTTGAAAGCCATAGTACTAATACCTAAAGCAGTGAA
CCAGATTCCTACTACAGGCCAAGCAGCCAAGAAGAAGTGTAAAGAACGAGAGTTGTTGAA
ACTAGCATATTGGAAGATTAATCGGCCAAAATAACCATGAGCAGCCACAATATTATAAGT
TTCTTCCTCTTGACCAAATTTGTAACCCTCATTAGCAGATTCATTTTCAGTAGTTTCCCT
GATCAAACTAGAGGTTACCAAGGAACCATGCATAGCACTGAATAGGGAACCGCCGAATAC
How this problem can be resolved?

--sjdbGTF...stuff from your command as it's likely there's an issue either with the GFF3 file or the fasta file. – Devon Ryan May 23 '18 at 11:51