As far as I'm aware, Illumina provide CSV annotation files for all their sequencing chips, which can be used when they can't be found in Bioconductor. You can find annotation information for the PorcineSNP60 here, in particular the Manifest file (CSV format). The format is Illumina's weird "we say it's a CSV because there are commas in it" format, so if there are only a few locations of interest it would be easier to use grep than try to work out the right way to load it into R (or similar).
For completeness, you want the lines between [Assay] and [Controls]. Here's an example way to pre-process the "CSV" file into a more standard format that just has one data table in it:
$ grep -n '^\[' PorcineSNP60v2_15031945_C1.csv
2:[Heading]
7:[Assay]
61574:[Controls]
### See that the table starts at line 8 (after [Assay]),
### and finishes at line 61753
$ tail -n +8 PorcineSNP60v2_15031945_C1.csv | head -n $((61574-8)) > cleaned_PorcineSNP60v2_15031945_C1.csv
But for a few markers and grep, it doesn't matter if you're working with the clean or dirty CSV file:
$ grep -e '^IlmnID' -e '^MARC0073381' -e '^ALGA0066960' PorcineSNP60v2_15031945_C1.csv
IlmnID,Name,IlmnStrand,SNP,AddressA_ID,AlleleA_ProbeSeq,AddressB_ID,AlleleB_ProbeSeq,GenomeBuild,Chr,MapInfo,Ploidy,Species,Source,SourceVersion,SourceStrand,SourceSeq,TopGenomicSeq,BeadSetID,Exp_Clusters,Intensity_Only
ALGA0066960-2_B_F_2199219285,ALGA0066960,BOT,[T/G],0054749354,TGCCACAGGTCTGCTCAGCTCAAGCCCAACACTCGCAAGATACAGGTCTA,,,10.2,12,55218591,diploid,Sus scrofa,PorcineSNP60v2,2,BOT,GGCTCACCTCTGCCACAGGTCTGCTCAGCTCAAGCCCAACACTCGCAAGATACAGGTCTA[T/G]CCAGGCTTCTCTCTCCTACTCCTAGGGCCCCTGATGGTTCCTGCATCCTGACCAATAGTG,CACTATTGGTCAGGATGCAGGAACCATCAGGGGCCCTAGGAGTAGGAGAGAGAAGCCTGG[A/C]TAGACCTGTATCTTGCGAGTGTTGGGCTTGAGCTGAGCAGACCTGTGGCAGAGGTGAGCC,670,3,0
MARC0073381-2_T_F_2199252059,MARC0073381,TOP,[A/G],0047761415,TGGAACGGATGGTGGAGACATTCTGGAGACAGAAGACAAACTGCTTCAGA,,,10.2,7,61808556,diploid,Sus scrofa,PorcineSNP60v2,2,TOP,CAACTGTGGTTGGAACGGATGGTGGAGACATTCTGGAGACAGAAGACAAACTGCTTCAGA[A/G]CAAAGCTCAGGAAGGCAA,CAACTGTGGTTGGAACGGATGGTGGAGACATTCTGGAGACAGAAGACAAACTGCTTCAGA[A/G]CAAAGCTCAGGAAGGCAA,660,3,0
I can see from this that the first marker is Chromosome 12, position 55218591, and the second marker is Chromosome 7, position 61808556. The Illumina annotation doesn't include the nearest gene, so you'll need to hunt for those locations on a genome browser (or using mapping with Bioconductor).