4

I have file 1 like following:


1   15776220    15776240    GTGACCAGCAGGTGTCTCTG    16855676    16855696    CTGTCCAGCAGAGGGCGGTG    

And file 2 as following


1   15776231    2   5008    G:5002  A:6 1   16855677    2   5008    A:5003  C:5

I am trying to write a code(but failing!) to do the following:

if $2 of file2 comes in between $2 and $3 of file1 (between the interval of $2 and $3) and if $8 of file2 comes in between $5 and $6 of file1 (between the interval of $5 and $6), then the output would be $1,$2,$3,$4 from file1 and $2,$3,$4,$5,$6 from file2 and $5,$6,$7 from file1 and $8,$9,$10,$11,$12 from file 2, all in one line. So something like this:

1   15776220    15776240    GTGACCAGCAGGTGTCTCTG    15776231    2   5008    G:5002  A:6 16855676    16855696    CTGTCCAGCAGAGGGCGGTG    16855677    2   5008    A:5003  C:5

Something like bedtools does but I am not able to use bedtools one this since I don't have two columns in file2. Is there any way to make bedtools work on this?

(There could be many lines from file2 intersecting between the same line in file1,so that line could be repeated)

rishi
  • 353
  • 1
  • 8
  • I see you took my advice, welcome to [bioinformatics.se]! How big are the files? Are they small enough to fit in RAM? Can we load one of the files in memory and then process the other? – terdon Dec 23 '17 at 11:54
  • Yes they can be worked on in the RAM itself, big but not huge. – rishi Dec 23 '17 at 13:24

2 Answers2

3

Pipe a modified form of the second file to BEDOPS bedmap and the first file, then pipe that result to cut out desired columns:

$ awk -v OFS='\t' '{ print $1, $2, ($2+1), $3, $4, $5, $6, $7, $8, $9, $10; }' second.txt | bedmap --echo --echo-map first.bed - | cut -f1-4,8,9,11- - > answer.bed

This should run pretty quickly and use very little memory, as it uses Unix streams on (presumably) sorted BED data.

You'll want to test the column indices in my answer by running this on your test inputs, but that's an easy adjustment for the larger dataset, in case I missed a column.

If you're not sure about sort order, pipe to sort-bed:

$ sort-bed first.unsorted.bed > first.bed
$ awk -v OFS='\t' '{ print $1, $2, ($2+1), $3, $4, $5, $6, $7, $8, $9, $10; }' second.txt | sort-bed - | bedmap --echo --echo-map first.bed - | cut -f1-4,8,9,11- - > answer.bed

Use streams where you can. It's a different way of thinking but can pay huge dividends.

Alex Reynolds
  • 3,135
  • 11
  • 27
  • Nice! What is the ($2+1) doing in your last awk command? I mean, I know what it does, it prints the value of the second field plus one, but why? – terdon Dec 24 '17 at 11:05
  • 1
    This creates a half-open interval that can be used for set operations. I'm assuming that both files are on the same coordinate system. If not, that can be adjusted with awk. – Alex Reynolds Dec 24 '17 at 14:06
  • Hey thanks for the script, but it doesn't give me any intersection. It only repeats $2 $3 and $5 $6 with the sequence in some lines, and I get no values from my second file in my answer – rishi Dec 27 '17 at 13:37
1

Here's one approach in Perl. Note that I have not tested this extensively, and I am not confident it works. Please test first and let me know if there are problems.

#!/usr/bin/env perl
use strict;
use warnings;
use 5.10.0;
my (@file1,%file2);
open(my $f1, '-|',"sort -nk2 $ARGV[0]");
while (<$f1>) {
  chomp;
  my @fields = split(/\s+/);
  push @file1, [ @fields ];
}
close($f1);

open(my $f2, "sort -nk2 $ARGV[1] |");
line:while (<$f2>) {
  chomp;
  my @fields = split(/\s+/);
  foreach my $file1Line (@file1) {
    my $file1Start1 = $file1Line->[1];
    my $file1End1 = $file1Line->[2];
    my $file1Start2 = $file1Line->[4];
    my $file1End2 = $file1Line->[5];
    my $file2Start1 = $fields[1];
    my $file2End1 = $fields[2];
    my $file2Start2 = $fields[7];
    my $file2End2 = $fields[8];
    my @file1Fields = @$file1Line;
    if ($file1Start1 < $file2Start1 &&
        $file1End1 > $file2End1 &&
        $file1Start2 < $file2Start2 &&
        $file1End2 > $file2End2) {
      say join "\t", @{$file1Line}[0..3], @fields[1..5], @{$file1Line}[4..6], @fields[7..11];
    }
    elsif ($file1Start1 > $file2Start1) {
      last;
    }
  }
}
close($f2);    

Save the script as foo.pl somewhere in your $PATH, make it executable and run as:

$ foo.pl file1.bed file2.bed 
1   15776220    15776240    GTGACCAGCAGGTGTCTCTG    15776231    2   5008    G:5002  A:6 16855676    16855696    CTGTCCAGCAGAGGGCGGTG    16855677    2   5008    A:5003  C:5
terdon
  • 10,071
  • 5
  • 22
  • 48
  • Hey thank you for the script. I think it almost works but there are problems. Shell gives a few Argument errors ("Argument "end" isn't numeric in numeric gt") for a lot of lines and "Use of uninitialized value $file2Start2 in numeric lt" for a lot of lines as well.

    However it does output a file, but with incorrect intersections and the number of lines in the file is 30 times more than the first file, which shouldn't be.

    The files are only 90kb and 30kb in size. Would you mind taking a closer look if I e-mailed them to you or something?

    – rishi Dec 27 '17 at 13:24
  • @MaharshiChakravortee this isn't a shell script. It's a perl script. Run it as I say in my answer, but making it executable and placing it in your PATH, or run it like this: perl foo.pl file1.bed file2.bed. If this still fails, ping me (@terdon) in chat. – terdon Dec 27 '17 at 13:32