I'm currently trying to run bwa-mem on Influenza substrains using the following command:
~/bwa mem h5n1_1_cons.fa h5n1_1_read1.fq h5n1_1_read2.fq
h5n1_1_cons.fa is the consensus sequence for substrain h5n1_1, and the fq files are paired end reads 1 and 2. Running the program gives me this error:
[mem_sam_pe] paired reads have different names: "JQ714243-920-1", "JQ714243-920-2"
Visual inspection shows that the read names are identical until the last character. I have found a package (bbmap) with a utility, bbrename.sh, that renames the sequences, producing:
./bbrename.sh in=h5n1_1_read1.fq out=fixed prefix=h5n1_1
which yields the following output
-bash-4.2$ head fixh5n1_1_read1.fq
@h5n1_0
gaaaatgtctcaggagttgatgcatggtgtttaatctttggtttgcgctg
+
@4>C5?7FA?9@@@;1,-4B+E??4E9,DA>6CB)*2.)?7/.'65+75/
@h5n1_1
catcagttggattttgcctaaggatgtccaccatccttatcccaccaatt
+
7(9?)=C3AEF+@@F=C-E>EE57CD:;'?.*?7;>:3>2.;29..)=2'
@h5n1_2
catgcatttgttggaataatgttctcacaaatcaactgtattgaccgctg
This fixes the problem and allows BWA-MEM to work. However, header information is discarded. Is there another way to ensure the header names are the same while retaining all header information?
awk 'NR % 4 == 1{print $1}' h5n1_1_read1.fq | headandawk 'NR % 4 == 1{print $1}' h5n1_1_read2.fq | headfor example. – terdon Nov 29 '17 at 11:08