4

I have the nucleotide sequence:

AATTGAGGCACATTTTTTTTTAGACAGTCTTGCTCTGTTGCCCAGGCTGGAGTGCAGTGGTGTGATCATAGCTCACTGCAGCCTCGACCTCCTGGGCTCAACAAAGCACACAGTGGGCGGATCCCCACCAG

When I blat this on UCSC Genome Browser, the first hit is a match which spans 6572 basepairs on chromosome 19, and essentially matches the first portion of the sequence to one spot on the genome, and the second portion to another part of the genome approximately 6.5kb downstream.

However when I use the BLAT command line tool, it doesn't find the second half of this match, it only matches the first portion.

Here are the flags I'm using:

-t=dna

-q=dna

-minIdentity=90

-out=blast8

How do I get the command line tool to mimic the behavior of BLAT on UCSC Genome Browser?

Set
  • 241
  • 1
  • 8

1 Answers1

5

The FAQ offers an answer:

I'm setting up my own Blat server and would like to use the same parameter values that the UCSC web-based Blat server uses.

We almost always expect there to be some small differences between the hgBlat/gfServer and the stand-alone command-line blat. The best matches can be found using pslReps and pslCDnaFilter utilities. The web-based blat is tuned permissively with a minimum cut-off score of 20, which will display most of the alignments. Other than to confirm that your command-line blat is working, there is little use in perfectly replicating the web-based blat results. We advise deciding which filtering parameters make the most sense for the experiment or analysis. Often these settings will be different and more stringent than those of the web-based blat. With that in mind, use the following settings to replicate the search results of the web-based blat:

[ . . . ]

standalone blat:

blat search:

blat -stepSize=5 -repMatch=2253 -minScore=0 -minIdentity=0 database.2bit query.fa output.psl 
terdon
  • 10,071
  • 5
  • 22
  • 48
Alex Reynolds
  • 3,135
  • 11
  • 27