4

I have a fastq file of 400,000 reads (so speed is important). In the sequences there are barcodes integrated that should be present twice. Given a barcode, I want to find the sequences that have the barcode present twice with <= 2 mismatches. So, with a barcode 'ATTCGACCGATAGG', I would like to retrieve all of the following sequences-

TATCTTGTGGAAAGGACGAAACACCGAACACAAAGCATAGATGCGTTTAAGAGCTATGCTGGAAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTATTCGACCGATAGGGGTGGCAGGGGAGGCCGAGGAGGAAGAAGGGGAGGTGGCAGATTCGACCGATAGGTGGCGTAACTAGATCTTGAGACAAA TATCTTGTGGAAAGGACGAAACACCGGTCCGAGCAGAAGAAGAAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTATTCGACCGATAGGGGTGGCAGGGGAGGCCGAGGAGGAAGAAGGGGAGGTGGCAGATTCGACCGATAGGTGGCGTAACTAGATCTTGAGACAAA TATCTTGTGGAAAGGACGAAACACCGAGTCCGAGCAGAAGAAGAAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTATTCGACCGATAGGGGTGGCAGGGGAGGCCGAGGAGGAAGAAGGGGAGGTGGCAGATTCGACCGATAGGTGGCGTAACTAGATCTTGAGACAAA TATCTTGTGGAAAGGACGAAACACCGAGTCCGAGCAGAAGAAGAAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTATTCGACGATAGGGGTGGCAGGGGAGGCCGAGGAGGAAGAAGGGGAGGTGGCAGATTCGACCGATAGGTGGCGTAACTAGATCTTGAGACAAA

Note that the first barcode in the fourth sequence is short of one character. I have tried with biopython and regex but it's just too slow given I have 5k barcodes. I am wondering if there is a fast solution available in python or in something like grep, awk or anything else. Thanks.

nafizh
  • 69
  • 2
  • Do you have any additional assumptions you can make? For example, are the pairs of barcodes within a specific distance from each other or the reads ends? I ask because with an edit distance of two (including indels) the chances of random matches will start to increase – GWW Jan 26 '21 at 04:47

1 Answers1

1

This isn't perfect but you can build on it to deal with any issues (ie overalpping hits). Also if you need it faster just chunk it and run in parallel threads.

I just copy pasted your examples seqs into files to read (called them seqs and code).

#need blast installed 
import subprocess
import pandas as pd

path = '/Users/ur/dir/' #make a blast db with open (path + 'seqs.txt', 'r') as fin: with open (path + 'seqs.fa', 'w') as fout: for i, line in enumerate(fin): fout.write('>'+str(i)+'\n') fout.write(line)

subprocess.run([ 'makeblastdb', '-in', path + 'seqs.fa', '-dbtype', 'nucl' ])

#use blast subprocess.run([ 'blastn', '-task', 'blastn-short', '-query', path + 'code.txt', '-db', path + 'seqs.fa', '-out', path + 'out.txt', '-outfmt', '6' ])

#grab seqs with 2 hits (ie ~2x len(query) df = pd.read_csv( path + 'out.txt', sep='\t', header=None, names=['query', 'db_name', 'percent','len'], usecols = [0,1,2,3] ) df = df.groupby('db_name').agg('sum') print(*list(df.query('len > 27').index))

I this case they are all hits. If you look at the blast output you'll see one hit was fragmented (blast isn't perfect with small seqs). But total len works to resolve this.

Liam McIntyre
  • 579
  • 4
  • 11