Assume we have a query.fa file that contains sequences and we run:
blat -stepSize=5 -repMatch=2253 -minScore=20 -minIdentity=0 -out=pslx /genomes/mm10.fa.qz query.fa output.pslx
the output output.pslx file looks like this:
match mis- rep. N's Q gap Q gap T gap T gap strand Q Q Q Q T T T T block blockSizes qStarts tStarts
match match count bases count bases name size start end name size start end count
---------------------------------------------------------------------------------------------------------------------------------------------------------------
20 0 0 0 0 0 0 0 + seq 20 0 20 chr9 124595110 44046930 44046950 20, 0, 44046930, aaaagtatcagtgtgtatag, aaaagtatcagtgtgtatag,
20 0 0 0 0 0 0 0 + seq 20 0 20 chr9 124595110 44046930 44046950 20, 0, 44046930, aaaagtatcagtgtgtatag, aaaagtatcagtgtgtatag,
What would be a reasonable way to get the genomic contexts (5bp upsteam and 5bp downstream) for each aligned sequence.
For example, assume that blat found that the seq: AAATTGGGGAAAA aligns to chr2:100-113, so the question is how to get chr2:95-118 easily without reinventing the wheel.
I couldn't make it work with bedtools, because my genome's index file is corrupted, but this should work for others who have successfully used bwa or samtools to index their reference genome:
blat -stepSize=5 -repMatch=2253 -minScore=20 -minIdentity=0 -out=pslx /genomes/mm10.fa.qz query.fa output.pslx
awk 'NR>5 {print $14 "\t" $16-10"\t" $17+10}' output.pslx > regions.bed
bedtools getfasta -fi /genomes/mm10.fa.gz -bed regions.bed
chr2 95 118inside, and then use it withbedtools getfastato extract your region – user3479780 Sep 03 '20 at 23:00