5

“The Iceman” was a man who lived 5300 years ago and whose body was recovered from an Alpine glacier in 1991. Some fungal material was recovered from his clothing and sequenced.

Ice man : found as a frozen corpse in the Val Senales Glacier in Italy.

Thought to be carrying Fomitopsis betulina (formerly known as Piptoporus betulinus) commonly known as birch polypore, birch bracket, or razor strop) is a common Basidiomycota brown rot macrofungus growing on decaying birch wood.

Other species known : Fomes fomentarius (commonly known as the tinder fungus, false tinder fungus, hoof fungus,] tinder conk, tinder polypore or ice man fungus)

Given two DNA fragments from NCBI genbank, try to find what species these DNA fragments belongs to or what species these fragments are most closely related to.

>Z54169.1 Iceman fungal clone 'Sim C-a1' 18S rRNA gene (partial)
GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCAC
CGCGTGTACTTGTCCGGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGAA
CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAAT
AATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCG
GGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCAT
TTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAG
TCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGA
GAAATCAAAGTTTTTGG
>Z54155.1 Iceman fungal clone 'Sim C-a2' 18S rRNA gene (partial)
GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGTCTGGCTGGCAGGTCCGCCTCAC
CGCGTGTACTTGTCCGGCCGGGCCTTCCTTCTGGAGAACCTCATGTCTTTTATTAGGCGTGTTGGGGACC
AGAACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAA
TAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGG
GGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTT
GCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTC
TTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGA
AATCAAAGTTTTTGG

Now I know I can just google what species of mushrooms (which is where the above background info is from). But say that I was unable to and had to just go off the DNA fragments in order to find the species.

I've tried BLASTn, but I'm not sure if it is the right tool or if I need to properly calibrate the parameters to use it.

so far, I've tried:

Under “Choose Search Set:
Database : Non-redundant protein sequences (nr)
Organisms excluded: Animalia (taxid:33208), Plantae, Prokaryota  (taxid:2), Protozoa 
Organisms included: fungi  (taxid:4751) 
Included: Models (XM/XP),   Uncultured/environmental sample sequences
Under Program Selection:  Optimized for Highly similar sequences (megablast)

Algorithm Parameters (General Parameters, Scoring Parameters, Filters and Masking, 
PS/PHI?DELTA BLAST) 

are all kept default. 
```
M__
  • 12,263
  • 5
  • 28
  • 47
  • 2
    So, what were the results? What makes you think this isn't the right approach? Did you not find any good hits? – terdon Dec 03 '19 at 09:38
  • For fungal species I think normally the ITS (internal transcribed spacer) is used for identification instead of 16s, 18s in your case. – Pallie Dec 03 '19 at 15:57

1 Answers1

1

My conclusion from the tree is the fungi appears to be genuine and not an extant contaminant (which is very easily done). It is not Fomitopsis betulina because this is division Basidiomycota. The fungi here is division Ascomycota and these are very distinct from Basidiomycota.

There have been many examples of contamination in ancient DNA work, but this doesn't appear to be one of them. The rationale is given below.

enter image description here

The first fragment was not interesting and described 100% identity to ascomycetes. The tree above is a simple distance tree from the second fragment of 18S which shows it is an outgroup to the ascomycetes (green terminal taxa). The ancient fungi contains 3 (I think) unique nucleotide residues that have not been sequenced in any extant ascomycetes to date and sequences are unique to any known species. The location of the 3 unique nucleotides is tightly clustered within the locus with 100% identities either side. This is significant because it demonstrates it is not a PCR mosaic artefact (yep its been done in ancient DNA work and subsequently proven artifactual). In the latter PCR mosaic artefact I'm referring to (which I wouldn't cite), was a fungi/bacterial mosaic from memory.

Given the homology of 18S in the extant ascomycetes I would say this appears to be a new genus, however you would need to be sure this was not sequencing error and this is very old DNA, which is subject to degradation even when frozen. The implication of the tree is quite unusual, it implies widespread extinction of this group of fungi in recent history (5000 years is slight in evolutionary terms) BUT it could be a sampling bias, i.e. no one has sequenced those fungi and NCBI is not representative.

I assume that you have performed phenotypic/morphological analysis on the spore to believe it is Basidiomycota.

The fragment in yellow is the query and the sequence next to it was the sequence already deposited on Genbank of this ancient isolate. You would need to look up the biology and ecology of ascomycete to understand its significance, but it is in a lineage of its own, so maybe difficult to interpret by comparison to extant species. You could concatenate the two alignments based on each fragment, but the problem with 18S is that is a hard to model and you'd need to perform secondary RNA structure modelling to assess whether these mutations would be viable.

In conclusion, it definitely looks genuine but it is not the species you think it is, in fact not even close.

M__
  • 12,263
  • 5
  • 28
  • 47